Gordon Liddle
ArtistUK
About Artist:
Born 1956, Horden, County Durham, United Kingdom Married, lives and works in his Derbyshire studio BA Hons, Sheffield Psalter Lane Art College Gordon has had numerous positions and travelled extensively through the Middle East, Saudi Arabia, Dubai, Yemen, Lebanon, Bahrain, Africa and Europe, with particular interests in religion, democracy, politics and culture. The results of these studies form the basis of the series of works now under way. Numerous works bought by private collectors #Madonna Victorian Mood Bought by Andrew Cavendish the 11th Duke of Devonshire is owned by the Chatsworth Collection ‘Celestial Teapot’ was exhibited at La Galleria Pall Mall in London for one week in 2013, 4 days at Art Basel in 2014 Gordon is on Twitter @sutongirotcip and his website is pictorignotus.com (from Jan 2015).
About Artwork:
This installation is part of a series of six works exploring Religion, Dogma, Politics and our ongoing war on the Environment. The painting is loosely based on the quote (carved into the end panel of the frame) by Bertrand Russell:- “If I were to suggest that between the Earth and Mars there is a china teapot revolving about the sun in an elliptical orbit, nobody would be able to disprove my assertion provided I were careful to add that the teapot is too small to be revealed even by our most powerful telescopes. But if I were to go on to say that, since my assertion cannot be disproved, it is an intolerable presumption on the part of human reason to doubt it, I should rightly be thought to be talking nonsense. If, however, the existence of such a teapot were affirmed in ancient books, taught as the sacred truth every Sunday, and instilled into the minds of children at school, hesitation to believe in its existence would become a mark of eccentricity and entitle the doubter to the attentions of the psychiatrist in an enlightened age or of the Inquisitor in an earlier time.” The work explores the artist’s reaction to religion from his own personal experiences and takes a view from the perspective of an atheist. The main figure offers you from the left hand, the teapot of Russell or from the right hand the option of taking a sceptical scientific view of life, as symbolised by the drop of blood dripping from the finger and changing to a central riff of DNA strand running throughout the painting. The eye, used to balance the main figure represents the argument by creationists of a divine hand, repudiated by science and biology. From Gordon Liddle;- “In Yemen, every Thursday afternoon, most Sheikhs have a qat (mild narcotic) meeting, where many tribal figures attend the Sheikh and chew qat. Whilst chewing, they mull over tribal and local business, set the world to rights and sort out quarrels etc. A little like going to a bar and chatting with your friends, only without any women allowed and quite often over life or death issues. At some stage during the afternoon, a religious leader would call to prayer and all then would leave the room to pray, except for a few non partakers left to carry on chewing. I would sit and draw people in the room or would write stuff in my notebooks for later translation to canvas. During the afternoon there would be a lull in conversation during which one of the religious leaders would take it upon himself to give a sermon, usually sparked off by something in the general discussion in the diwan. Everyone would have to be silent and listen for up to two hours whilst this chap railed against the US, women, bad men, bad Sheikhs, bad governance, bad health or bad anything, the dangers of drink, the dangers of the west, the dangers of loose women (again), all wound up nicely with the solution in Allah and in particular, his mosque, with the implicit threat of punishment for disobedience. I once got so tired (and angry due to being constantly harangued as the token Westerner) of listening to one sermon by a chap called Sheikh Mohammed (a Hamas representative in Yemen) that I intervened and started a long argument during which time the rest of the sitters were amazed that someone had questioned the Sheikh’s wisdom on these matters (that the West was the root of evil, the great Satan and devoid of belief etc). After defending my position for two hours during a more or less constant tirade, the Sheikh got up, picked up his Kalashnikov (on which he had been sitting) and stormed out of the chew, followed by his entourage. With hindsight it was a dumb thing to have done as it later emerged that he was expelled from Yemen after a shooting incident and after one of his sons had beheaded someone in a rage (the Lord’s apostle’s move in mysterious ways). Anyway, this scribble emerged the night after the incident. Once home I finished it and it became the script for ‘Behold, I Give You the Celestial Teapot (BBIL**) The poem describes wonder at our place in the universe and how at ease a rational being can be with the Theory of Evolution and take a non-teleological stance. It takes the view that the universe can be looked at in wonder and awe and that free thinking and rational discourse is always under threat from myths and occasionally mischievous groups, or even from our own rage, irrationality and humour. Taking a Cosmic view of life can open up perceptions of our existence if we avoid dogma (religious and ideological) and puritanical shackles. The figure in the painting is messianic as I think that using an icon style ‘takes the fight to the enemy as it were’……” “There are those who would take offence at such a perception and of articulating this in an artwork. However, every belief is subject to challenge and the artist has every right within his/her medium to do so, within a free society, directly and clearly, without recourse to apology…..” The painting has an egg tempera base with oil over painting and glazing. The main figure relief is in 24 carat gold leaf. The Japanese influenced Wenge timber frame is inlaid with Sycamore and Mother of Pearl across the front section. The central DNA sculpture sequence is ATTATGTTTAGCAAACCGCCGTGTCTAGCCAACCGGACTGACTGACTGACTG This sequence was chosen because it contains an example of the Origin of Replication in the DNA sequence (this specific component is underlined above). This particular sequence, found within a yeast genome, forms the point at which replication of DNA strand is initiated. DNA replication may proceed from this point bidirectionally (i.e. spreading in both directions along the DNA from the origin) or undirectionally (with the DNA opening like a zip in one direction from the origin).
Gordon Liddle
Behold I Give You the Celestial Teapot
- 2012
- 620 x 200 cm
- Fine Art Category: paintings
- Medium: Egg tempera base with oil and oil glazes over. Gold leaf on board.
- Origin: UK
- Certificate of Authenticity: yes
- Issued by: The artist
- Signed: Signed lower right
- Comments:
The work is free standing. Can be delivered anywhere in Europe (cost £6000 based on recent installation in Basel) It should be listed under Philosophy/Concept/Rhetorical but this isn't available on the site yet. The work is available for viewing at my studio in Derbyshire just off Junc29A M1. Ring (44)7712771112 to view, or e-mail me in advance.
- Visit Website
- Price: £144,000.00 GBP
- Seller: Gordon Liddle, UK
Contact Seller...
- More by this artist
- Get artist alerts
- Save to favourites
- Share on facebook
- Share on twitter
- Pin to Pinterest
- Share on LinkedIn
- Email this artwork
- Report this artwork
- Artplode ID: 901
- Artplode Seller ID: 463
About Artist:
Born 1956, Horden, County Durham, United Kingdom Married, lives and works in his Derbyshire studio BA Hons, Sheffield Psalter Lane Art College Gordon has had numerous positions and travelled extensively through the Middle East, Saudi Arabia, Dubai, Yemen, Lebanon, Bahrain, Africa and Europe, with particular interests in religion, democracy, politics and culture. The results of these studies form the basis of the series of works now under way. Numerous works bought by private collectors #Madonna Victorian Mood Bought by Andrew Cavendish the 11th Duke of Devonshire is owned by the Chatsworth Collection ‘Celestial Teapot’ was exhibited at La Galleria Pall Mall in London for one week in 2013, 4 days at Art Basel in 2014 Gordon is on Twitter @sutongirotcip and his website is pictorignotus.com (from Jan 2015).
About Artwork:
This installation is part of a series of six works exploring Religion, Dogma, Politics and our ongoing war on the Environment. The painting is loosely based on the quote (carved into the end panel of the frame) by Bertrand Russell:- “If I were to suggest that between the Earth and Mars there is a china teapot revolving about the sun in an elliptical orbit, nobody would be able to disprove my assertion provided I were careful to add that the teapot is too small to be revealed even by our most powerful telescopes. But if I were to go on to say that, since my assertion cannot be disproved, it is an intolerable presumption on the part of human reason to doubt it, I should rightly be thought to be talking nonsense. If, however, the existence of such a teapot were affirmed in ancient books, taught as the sacred truth every Sunday, and instilled into the minds of children at school, hesitation to believe in its existence would become a mark of eccentricity and entitle the doubter to the attentions of the psychiatrist in an enlightened age or of the Inquisitor in an earlier time.” The work explores the artist’s reaction to religion from his own personal experiences and takes a view from the perspective of an atheist. The main figure offers you from the left hand, the teapot of Russell or from the right hand the option of taking a sceptical scientific view of life, as symbolised by the drop of blood dripping from the finger and changing to a central riff of DNA strand running throughout the painting. The eye, used to balance the main figure represents the argument by creationists of a divine hand, repudiated by science and biology. From Gordon Liddle;- “In Yemen, every Thursday afternoon, most Sheikhs have a qat (mild narcotic) meeting, where many tribal figures attend the Sheikh and chew qat. Whilst chewing, they mull over tribal and local business, set the world to rights and sort out quarrels etc. A little like going to a bar and chatting with your friends, only without any women allowed and quite often over life or death issues. At some stage during the afternoon, a religious leader would call to prayer and all then would leave the room to pray, except for a few non partakers left to carry on chewing. I would sit and draw people in the room or would write stuff in my notebooks for later translation to canvas. During the afternoon there would be a lull in conversation during which one of the religious leaders would take it upon himself to give a sermon, usually sparked off by something in the general discussion in the diwan. Everyone would have to be silent and listen for up to two hours whilst this chap railed against the US, women, bad men, bad Sheikhs, bad governance, bad health or bad anything, the dangers of drink, the dangers of the west, the dangers of loose women (again), all wound up nicely with the solution in Allah and in particular, his mosque, with the implicit threat of punishment for disobedience. I once got so tired (and angry due to being constantly harangued as the token Westerner) of listening to one sermon by a chap called Sheikh Mohammed (a Hamas representative in Yemen) that I intervened and started a long argument during which time the rest of the sitters were amazed that someone had questioned the Sheikh’s wisdom on these matters (that the West was the root of evil, the great Satan and devoid of belief etc). After defending my position for two hours during a more or less constant tirade, the Sheikh got up, picked up his Kalashnikov (on which he had been sitting) and stormed out of the chew, followed by his entourage. With hindsight it was a dumb thing to have done as it later emerged that he was expelled from Yemen after a shooting incident and after one of his sons had beheaded someone in a rage (the Lord’s apostle’s move in mysterious ways). Anyway, this scribble emerged the night after the incident. Once home I finished it and it became the script for ‘Behold, I Give You the Celestial Teapot (BBIL**) The poem describes wonder at our place in the universe and how at ease a rational being can be with the Theory of Evolution and take a non-teleological stance. It takes the view that the universe can be looked at in wonder and awe and that free thinking and rational discourse is always under threat from myths and occasionally mischievous groups, or even from our own rage, irrationality and humour. Taking a Cosmic view of life can open up perceptions of our existence if we avoid dogma (religious and ideological) and puritanical shackles. The figure in the painting is messianic as I think that using an icon style ‘takes the fight to the enemy as it were’……” “There are those who would take offence at such a perception and of articulating this in an artwork. However, every belief is subject to challenge and the artist has every right within his/her medium to do so, within a free society, directly and clearly, without recourse to apology…..” The painting has an egg tempera base with oil over painting and glazing. The main figure relief is in 24 carat gold leaf. The Japanese influenced Wenge timber frame is inlaid with Sycamore and Mother of Pearl across the front section. The central DNA sculpture sequence is ATTATGTTTAGCAAACCGCCGTGTCTAGCCAACCGGACTGACTGACTGACTG This sequence was chosen because it contains an example of the Origin of Replication in the DNA sequence (this specific component is underlined above). This particular sequence, found within a yeast genome, forms the point at which replication of DNA strand is initiated. DNA replication may proceed from this point bidirectionally (i.e. spreading in both directions along the DNA from the origin) or undirectionally (with the DNA opening like a zip in one direction from the origin).



